SubtiBank SubtiBank
tapA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tapA

[protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|TasA] anchoring/assembly protein
locus
BSU_24640
pI
6.68
mw
28.92 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
function
[SW|biofilm formation]
product
[protein|BF97457E986656E4A9FE7A858F5BDF1759850D5C|TasA] anchoring/assembly protein
essential
no
synonyms
yqhD,yqxM

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.2|Amyloid protein synthesis, secretion and assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,554,486 2,555,247

    Phenotypes of a mutant

  • no biofilm formation [Pubmed|24488317]
  • The protein

    [SW|Localization]

  • attached to the cell surface (on the outside of the cell), associated with peptidoglycan [Pubmed|21477127]
  • secretion requires [protein|09B082BF39703F0D9A5980E643175DBD59F5B228|SipW] [Pubmed|10559173]
  • Expression and Regulation

    Operons

    genes
    [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]
    description
    [Pubmed|16430695]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16430695], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10464223,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
  • expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C429 (yqhD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2427 NBRP B. subtilis, Japan]
  • BKE24640 ([gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTTACCTCCTGTAAA, downstream forward: _UP4_AGCAATGAAGCTGATCAGTA
  • BKK24640 ([gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTTACCTCCTGTAAA, downstream forward: _UP4_AGCAATGAAGCTGATCAGTA
  • lacZ fusion

  • pGP1926 (in [SW|pAC6]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 21488983,25907113
  • Original publications

  • 18430133,18047568,18647168,20351052,16430695,10464223,17720793,19605685,20431016,10559173,21477127,21856853,21815947,23646920,24488317,25894589,26819068,29590605,30371005