SubtiBank SubtiBank
ymaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymaB

putative [SW|Nudix hydrolase]
locus
BSU_17400
pI
4.51
mw
23.24 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,872,128 1,872,748

    The protein

    Structure

  • [PDB|3E57] (from ''Thermotoga maritima'', 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|1EA0595C74359A36B9161CFD531CA894C5E66E25|nrdI]-[gene|3B68CE8E9A35997B45E437A316996D585E43B76B|nrdE]-[gene|CD2D14FE9C10544E7C350167EBDBD941B898051D|nrdF]-[gene|8C2A08A8395B72CCC9D03A8154602B8F3B77A1AA|ymaB]
    description
    [Pubmed|16885274]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16885274], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|16885274], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|FD4E988BB73F6476CCEA4C521F343D6F8CBA457F|NrdR]: repression, (predicted) [Pubmed|15949864], in [regulon|FD4E988BB73F6476CCEA4C521F343D6F8CBA457F|NrdR regulon]
  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: transcription repression, [Pubmed|27920297], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|16885274]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|ymzA]' and '[protein|search|nrdI]' [PubMed|20525796]
  • view in new tab

    genes
    [gene|93FA602438546FD6201FAB5BD19DB5DEB5965E48|ymzA]-[gene|1EA0595C74359A36B9161CFD531CA894C5E66E25|nrdI]-[gene|3B68CE8E9A35997B45E437A316996D585E43B76B|nrdE]-[gene|CD2D14FE9C10544E7C350167EBDBD941B898051D|nrdF]-[gene|8C2A08A8395B72CCC9D03A8154602B8F3B77A1AA|ymaB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B380 (ymaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1379 NBRP B. subtilis, Japan]
  • BKE17400 ([gene|8C2A08A8395B72CCC9D03A8154602B8F3B77A1AA|ymaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTACTGCGTCCTCCT, downstream forward: _UP4_TAAAAAAACCCGGTTTCTCG
  • BKK17400 ([gene|8C2A08A8395B72CCC9D03A8154602B8F3B77A1AA|ymaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGTACTGCGTCCTCCT, downstream forward: _UP4_TAAAAAAACCCGGTTTCTCG
  • References

  • 16885274,8969495,15949864,27920297