SubtiBank SubtiBank
sacA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sacA

phosphosucrase
locus
BSU_38040
pI
5.34
mw
54.72 kDa
protein length
480 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
utilization of sucrose
product
phosphosucrase
essential
no
ec
3.2.1.26
synonyms
ipa-50d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • Gene

    Coordinates
    3,902,210 → 3,903,649

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal non-reducing beta-D-fructofuranoside residues in beta-D-fructofuranosides (according to UniProt)
  • Protein family

  • glycosyl hydrolase 32 family (with [protein|33BEC05F2129EBAF6699E847B0909A5A48F0E869|LevB] and [protein|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|SacC], according to UniProt)
  • Structure

  • [PDB|3PIG] (beta-fructofuranosidase from Bifidobacterium longum, 29% identity) [pubmed|21418142]
  • Expression and Regulation

    Operons

    genes
    [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
    description
    [Pubmed|3100393]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8702561], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]: antitermination, via binding to a [SW|RNA switch], in [regulon|6796E1C147AA21E919A42A953884DC24E182F430|SacT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
  • view in new tab

    Biological materials

    Mutant

  • 1A810 ( ''sacA''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A810&Search=1A810 BGSC]
  • 1A811 ( ''sacA''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A811&Search=1A811 BGSC]
  • BKE38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC, downstream forward: _UP4_TAGAAAATCCTTCTATTTTC
  • BKK38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC, downstream forward: _UP4_TAGAAAATCCTTCTATTTTC
  • References

  • 3100393,8702561,2163394,21418142