SubtiBank SubtiBank
sacA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sacA

phosphosucrase
locus
BSU_38040
pI
5.34
mw
54.72 kDa
protein length
480 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
utilization of sucrose
product
phosphosucrase
essential
no
ec
3.2.1.26
synonyms
ipa-50d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.19|Utilization of sucrose]
  • Gene

    Coordinates
    3,902,210 → 3,903,649

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal non-reducing beta-D-fructofuranoside residues in beta-D-fructofuranosides (according to UniProt)
  • Protein family

  • glycosyl hydrolase 32 family (with [protein|33BEC05F2129EBAF6699E847B0909A5A48F0E869|LevB] and [protein|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|SacC], according to UniProt)
  • Structure

  • [PDB|3PIG] (beta-fructofuranosidase from Bifidobacterium longum, 29% identity) [pubmed|21418142]
  • Expression and Regulation

    Operons

    genes
    [gene|AE02C38397AA790E4B216BB6DBABFE907B984D05|sacP]-[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]-[gene|803ED978141A0E09F1F9CAECAB4BA839D480241F|ywdA]
    description
    [Pubmed|3100393]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8702561], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]: antitermination, via binding to a [SW|RNA switch], in [regulon|6796E1C147AA21E919A42A953884DC24E182F430|SacT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
  • view in new tab

    Biological materials

    Mutant

  • 1A810 ( ''sacA''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A810&Search=1A810 BGSC]
  • 1A811 ( ''sacA''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A811&Search=1A811 BGSC]
  • BKE38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC, downstream forward: _UP4_TAGAAAATCCTTCTATTTTC
  • BKK38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC, downstream forward: _UP4_TAGAAAATCCTTCTATTTTC
  • References

  • 3100393,8702561,2163394,21418142