SubtiBank SubtiBank
clpE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

clpE

AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease (class III stress gene)
locus
BSU_13700
pI
5.14
mw
77.72 kDa
protein length
699 aa Sequence Blast
gene length
2100 bp Sequence Blast
function
protein degradation
product
AAA unfoldase, ATPase subunit of the [protein|8C5B14FE5E03427F9A598C75D4081FA0D6696299|ClpE]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] protease
essential
no
synonyms
ykvH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    1,435,628 1,437,727

    The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • ClpA/ClpB family (with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC], according to UniProt)
  • Paralogous protein(s)

  • [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]
  • [SW|Domains]

  • AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
  • [SW|UVR domain] (aa 325-360) (according to UniProt)
  • Structure

  • [PDB|6EM8] ([protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] from Staphylococcus aureus, 54% identity) [pubmed|29165246]
  • [SW|Localization]

  • localization in cytoplasmic polar clusters, excluded from the nucleoid, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [http://www.ncbi.nlm.nih.gov/pubmed/18786145 Pubmed]
  • forms foci coincident with nucleoid edges, usually near cell poles [Pubmed|18689473]
  • Expression and Regulation

    Operons

    genes
    [gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]
    description
    [Pubmed|10320580]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10320580], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|10320580,9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat ([protein|search|CtsR]) [Pubmed|10320580,9987115]
  • view in new tab

    Biological materials

    Mutant

  • ''clpE::spec'' available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
  • BKE13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
  • BKK13700 ([gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCCAAAACCTCCTTA, downstream forward: _UP4_TAACAATCAGCGGTTTCCTT
  • GFP fusion

  • C-terminal YFP and CFP fusions (single copy) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1799 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • References

    Reviews

  • 26639779,28748186
  • Original Publications

  • 17302811,29165246
  • Labs working on this gene/protein

  • [SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]