SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


6.63 kDa
protein length
gene length
168 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,699,510 2,699,677

    The protein


  • cell membrane (according to UniProt)
  • Biological materials


  • BKE26360 ([gene|8CA66DC93017E9C38E660A961F8AC2CB62B6E70A|yqaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTAAACTCCTTTGAA, downstream forward: _UP4_TAACAAGAAGCCCTCTTTTC
  • BKK26360 ([gene|8CA66DC93017E9C38E660A961F8AC2CB62B6E70A|yqaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTAAACTCCTTTGAA, downstream forward: _UP4_TAACAAGAAGCCCTCTTTTC