SubtiBank SubtiBank
yacO

yacO

putative 23S rRNA 2'-O-ribose G2251 methyltransferase
locus
BSU_00960
pI
8.63
mw
27.36 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
function
rRNA modification
product
putative 23S rRNA methyltransferase
essential
no
ec
2.1.1.-
synonyms
rlmB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    115,269 116,018

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • class IV-like SAM-binding methyltransferase superfamily (with [protein|03BA7AEE17739689D632A35D9C3329EA0982C98A|CspR] and [protein|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|YsgA], according to UniProt)
  • Paralogous protein(s)

  • [protein|8A2898B80D0FFA56C5AA86C6F09D886A62AABBDA|YsgA]
  • [SW|Cofactors]

  • SAM (according to UniProt)
  • Structure

  • [PDB|1GZ0] (from ''E. coli'', 44% identity) [Pubmed|12377117]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|132E91DB8C81CD8C4F5160B2C068B74DA10AE224|gltX]-[gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE]-[gene|E5826A99769E2FE45959A9D623D6467A8DDDEB81|cysS]-[gene|031FDF8443A8A4D5B042B7591EBE2E6C74F07702|mrnC]-[gene|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|yacO]-[gene|172652156ABFE72D5BAAC22729CE17CA947538B5|yacP]
    description
    [Pubmed|7510287]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7510287], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|T-box|T-box]: transcription antitermination, overlaps a transcription terminator upstream of [gene|5B9D5DA130DC3654F386684156BDC350DD05DB60|cysE], in [regulon|T-box|T-box]
  • regulation

  • expression transiently increases in the forespore [Pubmed|22848659]
  • the [SW|T-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B884 (yacO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1883 NBRP B. subtilis, Japan]
  • BKE00960 ([gene|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|yacO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCATTTTTCCCTATGA, downstream forward: _UP4_AACCCTGTGGGAGAATAAAG
  • BKK00960 ([gene|8CB595F84D00D1262EB13E6CF47BE6F00EDE16A5|yacO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCATTTTTCCCTATGA, downstream forward: _UP4_AACCCTGTGGGAGAATAAAG
  • References

  • 19258532,7510287,12377117,11698387