SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


53.12 kDa
protein length
469 aa Sequence Blast
gene length
1410 bp Sequence Blast
salicin utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of beta-glucosides]
  • Gene

    4,032,346 4,033,755

    The protein

    Catalyzed reaction/ biological activity

  • 6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 1 family] (according to UniProt)
  • Structure

  • [PDB|4IPL] (from ''Streptococcus pneumoniae'', 60% identity) [Pubmed|23580646]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7559347], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] binding site overlaps -35 region) [Pubmed|7559347], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]: anti-termination, via [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent [SW|RNA switch], lack of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]-dependent antitermination in the presence of gucose due to the requirement of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT] to be phosphorylated by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK], in [regulon|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT regulon]
  • regulation

  • induced by salicin ([protein|search|LicT]) [Pubmed|7883710]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|bglP]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE39260 ([gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCACCCCATTAG, downstream forward: _UP4_TGACAATTTTTTGAAAACTC
  • BKK39260 ([gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCACCCCATTAG, downstream forward: _UP4_TGACAATTTTTTGAAAACTC
  • References

  • 14652714,16672620,15139916,7883710,7559347,26772920,23580646