SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cell wall hydrolase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer , C-terminal domain hydrolyzes bond between D-Glu and m-DAP
36.39 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
conjugative transfer of ICEBs1
cell wall hydrolase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    544,022 545,011

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of peptidoglycan (linkage between N-acetylmuramic acid and N-acetylglucosamine and bond between D--glutamate and meso-diaminopimelic acid) [Pubmed|18305117]
  • degradation of gamma-polyglutamic acid [pubmed|29458655]
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • [SW|Domains]

  • N-terminal domain is an N-acetylmuramidase that cleaves the linkage between N-acetylmuramic acid and N-acetylglucosamine [Pubmed|18305117]
  • C-terminal D,L-endopeptidase domain ([SW|NlpC/P60 domain]) [pubmed|29458655,22139507], cleaves the bond between D--glutamate and meso-diaminopimelic acid [Pubmed|18305117]
  • Effectors of protein activity

  • both enzymatic activities are inhibited by interaction with [protein|0CA55371306D4BD768CFA82027DCB4D581BCCB87|IseA] [pubmed|29458655]
  • Structure

  • [PDB|4FDY] (from Staphylococcus aureus, 42% identity) [pubmed|24051416]
  • [SW|Localization]

  • secreted (with signal peptide) [Pubmed|24532767]
  • may be a lipoprotein, but the lipid anchor is not required for function [Pubmed|24532767]
  • Expression and Regulation



    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • regulation

  • strongly induced in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE04970 ([gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
  • BKK04970 ([gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCTTGTTCTTTCATC, downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
  • References

  • 18305117,24532767,24051416,29458655,32419322