SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transmembrane modulator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] activity, activates [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] autophosphorylation and substrate phosphorylation
26.49 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast
control of protein tyrosine phosphorylation
modulator of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,732,525 3,733,271

    Phenotypes of a mutant

  • the mutant exhibits a defect in [SW|biofilm formation], pronounced on LBGM medium, weak of MSgg medium [Pubmed|26283769,20815827], this can be compensated for by overexpression of ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]'' or by mutations that reduce the expression of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|26283769]
  • The protein

    Catalyzed reaction/ biological activity

  • transmembrane activation of [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] protein tyrosine kinase activity
  • Protein family

  • CapA family (with [protein|A696434A086A428D411CAF45B37CD8F82AC2503F|CapA] and [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|EpsA], according to UniProt)
  • CpsC/CapA family (with [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|EpsA], according to UniProt)
  • Paralogous protein(s)

  • [protein|F6C4634BF871D9A01E27014FFED7527C54BF560D|EpsA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20815827], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|26283769], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|26283769], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-A034 (ywqC::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1566 (spc) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • GP1567 ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]''::aphA3 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]''::spc [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • BKE36260 ([gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATACCTCCAAATCTCT, downstream forward: _UP4_TCTGAAAAAACGGGGAGTGG
  • BKK36260 ([gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATACCTCCAAATCTCT, downstream forward: _UP4_TCTGAAAAAACGGGGAGTGG
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1620 ''tkmA''-FLAG 3x spc (based on [SW|pGP1331]) available in [SW|Jörg Stülke]'s lab
  • References

  • 12970183,20815827,20817675,23939619,24493247,26283769,27725816