SubtiBank SubtiBank
buk
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

buk

butyrate kinase
locus
BSU_24070
pI
5.47
mw
39.61 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
function
utilization of branched-chain keto acids
product
butyrate kinase
essential
no
ec
2.7.2.7
synonyms
yqiU,bkd

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • Gene

    Coordinates
    2,501,549 2,502,640

    The protein

    Catalyzed reaction/ biological activity

  • ATP + butanoate --> ADP + butanoyl phosphate (according to UniProt)
  • Protein family

  • acetokinase family (with [protein|DAA285C86692E8B47D48652E0973AE3FF091CBC3|AckA], according to UniProt)
  • Structure

  • [PDB|1X9J] (from ''Thermotoga maritima'', 52% identity, 69% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10094682], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR]: activation, [Pubmed|10094682], in [regulon|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C378 (yqiU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2376 NBRP B. subtilis, Japan]
  • BKE24070 ([gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATAACCTCCAGATCAA, downstream forward: _UP4_TAGACAGACAGGAGTGAGTC
  • BKK24070 ([gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATAACCTCCAGATCAA, downstream forward: _UP4_TAGACAGACAGGAGTGAGTC
  • References

  • 12427936,15241682,10094682,12823818