SubtiBank SubtiBank
bceA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

bceA

primary bacitracin resistance determinant, [SW|ABC transporter] (ATP-binding protein), protects cell wall biosynthetic targets from inhibition by antimicrobial peptides
locus
BSU_30380
pI
9.29
mw
28.08 kDa
protein length
253 aa Sequence Blast
gene length
762 bp Sequence Blast
function
protection of cell wall biosynthetic targets from inhibition by antimicrobial peptides
product
[SW|ABC transporter] (ATP-binding protein) for target protection of cell wall synthesis
essential
no
synonyms
ytsC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.3|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,111,327 3,112,088

    Phenotypes of a mutant

  • 85-fold increased sensitivity to bacitracin [Pubmed|26815905]
  • The protein

    Catalyzed reaction/ biological activity

  • releaves intermediates of the lipid II cycle from the inhibitory interaction with antimicrobial peptides such as bacitracin [pubmed|31871088]
  • Protein family

  • [SW|ABC transporter] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|FE3A01BEA974C5E32C68DC600C800E5EF101B34F|YknY], [protein|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|YtrE], [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL], [protein|464DD1855E6B3195EE242637612A16C73FF32FC0|PsdA], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 4-243) (according to UniProt)
  • Effectors of protein activity

  • the activity of the [protein|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|BceA]-[protein|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|BceB] [SW|ABC transporter] is inhibited by heptaprenyl pyrophosphate which accumulates in a ''[gene|596C09DD1D9C305B7C49B2F5E90E2C6C33F63D0E|ytpB]'' mutant [Pubmed|24806199]
  • Structure

  • [PDB|1L2T] (MJ0796 from '' Methanocaldococcus jannaschii '', 38% identity) [Pubmed|12150914]
  • [SW|Localization]

  • membrane associated (via [protein|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|BceB]) [Pubmed|12890034]
  • Expression and Regulation

    Operons

    genes
    [gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]-[gene|E3613A6C8B5F0EC76510ACE3E478967E73E2B241|bceB]
    description
    [Pubmed|12890034]

    regulatory mechanism

  • [protein|C239C155F5452C86BF6C78190BABBBB07A63DF87|BceR]: activation, [Pubmed|12890034], in [regulon|C239C155F5452C86BF6C78190BABBBB07A63DF87|BceR regulon]
  • regulation

  • induced in the presence of bacitracin, plectasin, mersacidin and actagardine, already at very low levels of bacitracin ([protein|search|BceR]) [Pubmed|12890034,26815905]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A167 (ytsC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/167 NBRP B. subtilis, Japan]
  • BKE30380 ([gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACGCAGTCTCCTTTA, downstream forward: _UP4_CAAGGCGTGTTAGGCGGGGT
  • BKK30380 ([gene|8E0DE8FE7E9C12495C4DCADA74D838FED088867D|bceA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACGCAGTCTCCTTTA, downstream forward: _UP4_CAAGGCGTGTTAGGCGGGGT
  • labs

  • [SW|Susanne Gebhard], Bath UK
  • References

    Reviews

  • 27344142,28152228,29404338
  • Original publications

  • 17905982,18394148,12890034,14651641,10092453,14612242,21283517,20606066,21078927,23687272,24806199,25118291,26199330,26364265,12150914,27997719,26815905,31871088,32019833