SubtiBank SubtiBank
glcK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glcK

glucose kinase (D-glucose:ATP)
locus
BSU_24850
pI
5.99
mw
33.39 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
function
phosphorylation of the free glucose moiety resulting from cleavage of di-and oligosaccharides
product
glucose kinase (D-glucose:ATP)
essential
no
ec
2.7.1.2
synonyms
yqgR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.20|Utilization of trehalose]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.22|Utilization of maltose]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • Gene

    Coordinates
    2,570,606 2,571,571

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-glucose --> ADP + D-glucose 6-phosphate + H+ (according to UniProt)
  • Protein family

  • ROK (NagC/XylR) family (with [protein|EB6DE119E6FB18413DB2C2B62B114FB787164F74|GmuE] and [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR], according to UniProt)
  • Paralogous protein(s)

  • [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]
  • Structure

  • [PDB|2QM1] (from ''Enterococcus faecalis'', 38% identity, 52% similarity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|89C51789FBB2EE86771ABD8629FD99748ED5D4EF|yqgP]-[gene|C44F6723A2F1A627A0B9042871A07F5365D6121A|yqgO]-[gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]-[gene|2B33F2F9C2FB0767B72A29D060037393C88ACEE5|yqgS]
    description
    [pubmed|22383849]

    additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials

    Mutant

  • GP2 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE24850 ([gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCATATCTCGTCCATTTTTA, downstream forward: _UP4_TAAAATTGTGTAAATGAAAT
  • BKK24850 ([gene|8E10A8B566BC25CBDDEF1503656A4234FD29ACB8|glcK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCATATCTCGTCCATTTTTA, downstream forward: _UP4_TAAAATTGTGTAAATGAAAT
  • References

  • 9620975,15050034,15018644,16707683,7952186,27324299