SubtiBank SubtiBank
nicK
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nicK

DNA relaxase, similar to transposon protein
locus
BSU_04870
pI
5.13
mw
40.78 kDa
protein length
352 aa Sequence Blast
gene length
1059 bp Sequence Blast
function
conjugation of ICE BS1
product
DNA relaxase, similar to transposon protein
essential
no
synonyms
ydcR

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    Coordinates
    534,773 535,831

    The protein

    Protein family

  • plasmid replication initiation factor family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|ydcO]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE04870 ([gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCATTCGCTTCGCT, downstream forward: _UP4_TAAAACCAAGCTGCTAAACC
  • BKK04870 ([gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATCCATTCGCTTCGCT, downstream forward: _UP4_TAAAACCAAGCTGCTAAACC
  • References

    Reviews

  • 19943906
  • Original Publications

  • 17693500,19943900