SubtiBank SubtiBank
tdh
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tdh

L-threonine dehydrogenase
locus
BSU_16990
pI
6.06
mw
36.84 kDa
protein length
347 aa Sequence Blast
gene length
1044 bp Sequence Blast
function
threonine utilization
product
L-threonine dehydrogenase
essential
no
ec
1.1.1.103
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • Gene

    Coordinates
    1,770,461 1,771,504

    The protein

    Catalyzed reaction/ biological activity

  • L-threonine + NAD+ --> (2S)-2-amino-3-oxobutanoate + H+ + NADH (according to UniProt)
  • Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • [SW|Cofactors]

  • NAD+ (according to UniProt)
  • Structure

  • [PDB|2DQ4] (from ''Thermus thermophilus'', 47% identity, 63% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]-[gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE16990 ([gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACAATCCTCCTTGAA, downstream forward: _UP4_TTAATTCCATAAAGGGGGAT
  • BKK16990 ([gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACAATCCTCCTTGAA, downstream forward: _UP4_TTAATTCCATAAAGGGGGAT