SubtiBank SubtiBank
ydgI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydgI

putative nitroreductase
locus
BSU_05660
pI
4.65
mw
23.21 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    612,191 612,820

    The protein

    Protein family

  • [SW|nitroreductase family] (according to UniProt)
  • Structure

  • [PDB|3GE6] (from Exiquobacterium sibiricum, 70% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]-[gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C175 (ydgI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2173 NBRP B. subtilis, Japan]
  • BKE05660 ([gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATCATGTTGATACACTC, downstream forward: _UP4_TGCCGATTGATACAATTGCAG
  • BKK05660 ([gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATCATGTTGATACACTC, downstream forward: _UP4_TGCCGATTGATACAATTGCAG