SubtiBank SubtiBank
rhiN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rhiN

galacturonyl hydrolase, catalyses intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
locus
BSU_07000
pI
4.76
mw
38.52 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
product
galacturonyl hydrolase, catalyses intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
essential
no
synonyms
yesR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    764,781 765,815

    The protein

    Catalyzed reaction/ biological activity

  • 2-O-(4-deoxy-β-L-threo-hex-4-enopyranuronosyl)-α-L-rhamnopyranose + H2O --> 5-dehydro-4-deoxy-D-glucuronate + L-rhamnopyranose (according to UniProt)
  • Protein family

  • glycosyl hydrolase 105 family (with [protein|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|YteR], according to UniProt)
  • Structure

  • [PDB|3PMM] (from Klebsiella pneumoniae, 30% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A96A83684E1E6E8705265D3932DA60FF47C23E3B|rhiL]-[gene|2DC415DCC2ECC3B46526108638DDB46C28832041|rhiF]-[gene|0B11FACEB5E96D166AC1EA0E32C68FCDAF8327E4|rhiG]-[gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]
    description
    [Pubmed|33122638]

    regulation

  • induced in colonies growing on steamed soybeans [Pubmed|33122638]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B260 (yesR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1259 NBRP B. subtilis, Japan]
  • BKE07000 ([gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTGCCATCTGCAACACTC, downstream forward: _UP4_TAAAGATAGCGGCGGGGGGA
  • BKK07000 ([gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTGCCATCTGCAACACTC, downstream forward: _UP4_TAAAGATAGCGGCGGGGGGA
  • References

  • 16781735,17449691,24391637