SubtiBank SubtiBank
rhiN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhiN

galacturonyl hydrolase, catalyses intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
locus
BSU_07000
pI
4.76
mw
38.52 kDa
protein length
344 aa Sequence Blast
gene length
1035 bp Sequence Blast
function
intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
product
galacturonyl hydrolase, catalyses intracellular degradation of disaccharides generated by [protein|217BAA94FB926CDA7CA8800BC6B08371792CEE31|YesX]
essential
no
synonyms
yesR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    764,781 765,815

    The protein

    Catalyzed reaction/ biological activity

  • 2-O-(4-deoxy-β-L-threo-hex-4-enopyranuronosyl)-α-L-rhamnopyranose + H2O --> 5-dehydro-4-deoxy-D-glucuronate + L-rhamnopyranose (according to UniProt)
  • Protein family

  • glycosyl hydrolase 105 family (with [protein|40787292458E5C6676F9F4F6F34C0D6BD5313DE1|YteR], according to UniProt)
  • Structure

  • [PDB|3PMM] (from Klebsiella pneumoniae, 30% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials

    Mutant

  • MGNA-B260 (yesR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1259 NBRP B. subtilis, Japan]
  • BKE07000 ([gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTGCCATCTGCAACACTC, downstream forward: _UP4_TAAAGATAGCGGCGGGGGGA
  • BKK07000 ([gene|8EED04FCE6E2900B729178209FB281F5463B2540|rhiN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTGCCATCTGCAACACTC, downstream forward: _UP4_TAAAGATAGCGGCGGGGGGA
  • References

  • 16781735,17449691,24391637