SubtiBank SubtiBank
menF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

menF

menaquinone-specific isochorismate synthase
locus
BSU_30830
pI
4.71
mw
52.65 kDa
protein length
471 aa Sequence Blast
gene length
1416 bp Sequence Blast
function
biosynthesis of menaquinone
product
menaquinone-specific isochorismate synthase
essential
no
ec
5.4.4.2
synonyms
icsM,entC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.8|Biosynthesis of menaquinone]
  • Gene

    Coordinates
    3,152,302 3,153,717

    The protein

    Catalyzed reaction/ biological activity

  • chorismate --> isochorismate (according to UniProt)
  • Protein family

  • isochorismate synthase family (with [protein|0D4D200095AD4F9B30179B9AF500306EDA61F5D1|DhbC], according to UniProt)
  • Structure

  • [PDB|3BZM] (from ''Escherichia coli'', 33% identity, 51% similarity) [Pubmed|18453696]
  • Expression and Regulation

    Operons

    genes
    [gene|8EFE4D2B07E54A0EE7D6821C9FEBFC7DC22FDE03|menF]-[gene|E3283812B7EB374EAC8722ECCE28432DE24B7B4C|menD]-[gene|74659B6794496912E139B3CF9EFF787B63729A3F|ytxM]-[gene|224584953B0BC1AF666CD69372B2D53AC56F6752|menB]-[gene|16412BAB04BBF9FD1C3653328923687874C81868|menE]-[gene|9B2F45BC37D4F356B366447A33DC95639EF484EE|menC]
    description
    [Pubmed|9387221,1629163,8550504]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550504], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mntA]' and '[protein|search|menC]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE30830 ([gene|8EFE4D2B07E54A0EE7D6821C9FEBFC7DC22FDE03|menF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGACATTCCTCCATAA, downstream forward: _UP4_TCTGCATTAGGAGGTGAGAG
  • BKK30830 ([gene|8EFE4D2B07E54A0EE7D6821C9FEBFC7DC22FDE03|menF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGACATTCCTCCATAA, downstream forward: _UP4_TCTGCATTAGGAGGTGAGAG
  • References

  • 9387221,1629163,8550504