SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] trans-envelope complex, required for the activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
9.62 kDa
protein length
gene length
180 bp Sequence Blast
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]
component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] trans-envelope complex

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    2,555,887 2,556,066

    Phenotypes of a mutant

  • reduced [SW|sporulation] efficiency (14% compared to wild type) [Pubmed|26735940]
  • the ''[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL] [gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]'' double mutant has a severe [SW|sporulation] defect (0.001%) [Pubmed|26735940]
  • The protein


  • forespore [Pubmed|26735940]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [ Reference]
  • view in new tab



  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [ Reference]
  • view in new tab

    Biological materials


  • MGNA-C472 (yqzE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24660 ([gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATCACCTCATCATT, downstream forward: _UP4_TAACCGCAAATAAACGAATA
  • BKK24660 ([gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATCACCTCATCATT, downstream forward: _UP4_TAACCGCAAATAAACGAATA
  • References


  • 31350897
  • Original Publications

  • 2507524,23033921,12107147,8196543,26735940