SubtiBank SubtiBank
yvyE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvyE

unknown
locus
BSU_35510
pI
5.80
mw
24.69 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yvhK

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,646,753 3,647,406

    The protein

    Protein family

  • IMPACT family (single member, according to UniProt)
  • Structure

  • [PDB|2CVE] (from Thermus thermophilus, 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]-[gene|E244A5ABB2FBD4FC3880F0DB700BD935991AE6DD|tagV]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A348 (yvyE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/348 NBRP B. subtilis, Japan]
  • BKE35510 ([gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTAGCTGACCCTCCTG, downstream forward: _UP4_AATCACATAAAGGAGACTGA
  • BKK35510 ([gene|8F46DEAD6195B566E1A5FDC6E6ED9D29969F4AFA|yvyE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTAGCTGACCCTCCTG, downstream forward: _UP4_AATCACATAAAGGAGACTGA
  • References

  • 14651647,22383849