SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


N-acetylglucosamine-6-phosphate deacetylase
42.46 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
N-acetylglucosamine utilization
N-acetylglucosamine-6-phosphate deacetylase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • Gene

    3,595,356 3,596,546

    Phenotypes of a mutant

  • no growth on N-acetylglucosamine [Pubmed|23667565]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + N-acetyl-D-glucosamine 6-phosphate --> acetate + D-glucosamine 6-phosphate (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Kinetic information

  • K(M): 1.4 mM [Pubmed|14343123]
  • Structure

  • [PDB|2VHL] [Pubmed|14557261]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR]: repression, [Pubmed|24673833,21602348], in [regulon|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|24673833,21602348,14343123]
  • view in new tab

    Biological materials


  • MGNA-A337 (nagA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35010 ([gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATGATCCGCCTTTCT, downstream forward: _UP4_ATATCCAAGGAGGCTGACCA
  • BKK35010 ([gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATGATCCGCCTTTCT, downstream forward: _UP4_ATATCCAAGGAGGCTGACCA
  • References


  • 26159076
  • Original publications

  • 10627040,14343123,12850135,6174502,14557261,23667565,21602348,24673833,23876412,25564531