SubtiBank SubtiBank
nagA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nagA

N-acetylglucosamine-6-phosphate deacetylase
locus
BSU_35010
pI
5.28
mw
42.46 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
function
N-acetylglucosamine utilization
product
N-acetylglucosamine-6-phosphate deacetylase
essential
no
ec
3.5.1.25
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.3|Utilization of cell wall components]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • Gene

    Coordinates
    3,595,356 3,596,546

    Phenotypes of a mutant

  • no growth on N-acetylglucosamine [Pubmed|23667565]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + N-acetyl-D-glucosamine 6-phosphate --> acetate + D-glucosamine 6-phosphate (according to UniProt)
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Kinetic information

  • K(M): 1.4 mM [Pubmed|14343123]
  • Structure

  • [PDB|2VHL] [Pubmed|14557261]
  • Expression and Regulation

    Operons

    genes
    [gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]-[gene|0C8D7EAC2656E989E45B5B7E42FAA6D258956B56|nagB]-[gene|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|nagR]
    description
    [Pubmed|21602348]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR]: repression, [Pubmed|24673833,21602348], in [regulon|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|24673833,21602348,14343123]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A337 (nagA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/337 NBRP B. subtilis, Japan]
  • BKE35010 ([gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATGATCCGCCTTTCT, downstream forward: _UP4_ATATCCAAGGAGGCTGACCA
  • BKK35010 ([gene|8F4D075C9B9EF995E361F9BA5E8B52F42059C422|nagA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGATGATCCGCCTTTCT, downstream forward: _UP4_ATATCCAAGGAGGCTGACCA
  • References

    Reviews

  • 26159076
  • Original publications

  • 10627040,14343123,12850135,6174502,14557261,23667565,21602348,24673833,23876412,25564531