SubtiBank SubtiBank
yhdR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdR

similar to aspartate aminotransferase
locus
BSU_09570
pI
5.01
mw
43.73 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.6.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,034,046 1,035,227

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + L-aspartate --> L-glutamate + oxaloacetate (according to UniProt)
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|3ELE] (from Eubacterium rectale, 34% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • The gene is annotated in KEGG as aspartate aminotransferase EC 2.6.1.1. In MetaCyc the protein is marked as similar to aspartate aminotransferase. No EC annotation is available in Swiss-Prot. No literature/experimental evidence supporting the annotation is availablavailable. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B485 (yhdR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1484 NBRP B. subtilis, Japan]
  • BKE09570 ([gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT, downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAA
  • BKK09570 ([gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT, downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAA