SubtiBank SubtiBank
yhdR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhdR

similar to aspartate aminotransferase
locus
BSU_09570
pI
5.01
mw
43.73 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.6.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,034,046 1,035,227

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + L-aspartate --> L-glutamate + oxaloacetate (according to UniProt)
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|3ELE] (from Eubacterium rectale, 34% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • The gene is annotated in KEGG as aspartate aminotransferase EC 2.6.1.1. In MetaCyc the protein is marked as similar to aspartate aminotransferase. No EC annotation is available in Swiss-Prot. No literature/experimental evidence supporting the annotation is availablavailable. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B485 (yhdR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1484 NBRP B. subtilis, Japan]
  • BKE09570 ([gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT, downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAA
  • BKK09570 ([gene|8F7432F7EF0F767C6000D553A3ACE29FBA2EDCEE|yhdR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT, downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAA