SubtiBank SubtiBank
cotP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotP

inner spore coat protein
locus
BSU_05550
pI
4.56
mw
16.91 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
resistance of the spore
product
inner spore coat protein
essential
no
synonyms
ydfT

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.5|Class V]
  • Gene

    Coordinates
    601,741 602,172

    The protein

    Protein family

  • [SW|small heat shock protein (Hsp20) family] (according to UniProt)
  • [SW|Domains]

  • sHSP domain (aa 34-143) (according to UniProt)
  • [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|68E585F6670539982E8E8032337DA2043C67FCC4|ydgB]-[gene|483587EB658850D786C3C95C02D419994FCC9F45|ydgA]-[gene|8F85E6DE353F29759301A463335BFC15F829E2D0|cotP]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|9068633], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation ([protein|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|SigKC]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C172 (ydfT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2170 NBRP B. subtilis, Japan]
  • BKE05550 ([gene|8F85E6DE353F29759301A463335BFC15F829E2D0|cotP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGATTCTCCTTAAA, downstream forward: _UP4_GGGCTTTAAGATTGATTGTT
  • BKK05550 ([gene|8F85E6DE353F29759301A463335BFC15F829E2D0|cotP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAGATTCTCCTTAAA, downstream forward: _UP4_GGGCTTTAAGATTGATTGTT
  • References

  • 11150673,15699190,9068633,22171814,26187959