SubtiBank SubtiBank
ddcA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ddcA

DNA damage checkpoint antagonist, prevents [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA]-dependent cell elongation
locus
BSU_28240
pI
4.39
mw
35.70 kDa
protein length
334 aa Sequence Blast
gene length
1005 bp Sequence Blast
function
control of [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA] activity
product
DNA damage checkpoint antagonist
essential
no
synonyms
ysoA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • Gene

    Coordinates
    2,887,817 2,888,821

    Phenotypes of a mutant

  • sensitive to DNA damage exposure, this can be rescued by deletion of [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA] [pubmed|30315724]
  • The protein

    [SW|Domains]

  • three [SW|TPR repeat|tetratrichopeptide repeats] [pubmed|30315724]
  • [SW|Localization]

  • cytosol [pubmed|30315724]
  • Biological materials

    Mutant

  • MGNA-A995 (ysoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/995 NBRP B. subtilis, Japan]
  • BKE28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG, downstream forward: _UP4_TAAATCGCGCCATATAGTTG
  • BKK28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG, downstream forward: _UP4_TAAATCGCGCCATATAGTTG
  • References

    Research papers

  • 30315724