The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ddcA

DNA damage checkpoint antagonist, prevents [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA]-dependent cell elongation

locus: BSU_28240

pI: 4.39

mw: 35.70 kDa

protein length: 334 aa

gene length: 1005 bp

function: control of [protein|7BF591DCDC9635C605D76135481A8A9DB63EE861|YneA] activity

product: DNA damage checkpoint antagonist

essential: no

synonyms: ysoA

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]

Gene

Coordinates: 2,887,817 2,888,821

Phenotypes of a mutant

• sensitive to DNA damage exposure, this can be rescued by deletion of [gene|7BF591DCDC9635C605D76135481A8A9DB63EE861|yneA] [pubmed|30315724]

The protein

[SW|Domains]

• three [SW|TPR repeat|tetratrichopeptide repeats] [pubmed|30315724]

[SW|Localization]

• cytosol [pubmed|30315724]

Biological materials

Mutant

• MGNA-A995 (ysoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/995 NBRP B. subtilis, Japan]
• BKE28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG, downstream forward: _UP4_TAAATCGCGCCATATAGTTG
• BKK28240 ([gene|8F8CFC1F80227BA791AAAB884E6485C27A78C31A|ddcA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCTATATTCCTTTCAG, downstream forward: _UP4_TAAATCGCGCCATATAGTTG

References

Research papers

• 30315724