SubtiBank SubtiBank
yhfI

yhfI

phosphodiesterase
locus
BSU_10240
pI
5.61
mw
26.38 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
unknown
product
phosphodiesterase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,098,412 1,099,146

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Manganese [pubmed|31481231]
  • Structure

  • [PDB|6KNS] (space group I4122)
  • [PDB|6KNT] (space group P4332)
  • Expression and Regulation

    Operons

    genes
    [gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]-[gene|F68611DF326880FCCB4EE3C2B364ECCC3DEAD78D|lplJ]-[gene|2DA0641FA6EC81072DA585D65FE17B7E5A010AC9|yhfK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE10240 ([gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTCCTCCTATCTTT, downstream forward: _UP4_TGGGAAGGATAAAGGAGGAG
  • BKK10240 ([gene|8FA225FA26DB0B89812A835EB928F2C8892EBC89|yhfI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTCCTCCTATCTTT, downstream forward: _UP4_TGGGAAGGATAAAGGAGGAG
  • References

    Research papers

  • 31481231