SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cytochrome P450 enzyme
44.70 kDa
protein length
395 aa Sequence Blast
gene length
1188 bp Sequence Blast
biosynthesis of biotin
cytochrome P450 enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of biotin]
  • Gene

    3,089,226 3,090,413

    The protein

    Catalyzed reaction/ biological activity

  • formation of pimelic acid via a multiple-step oxidative cleavage of long-chain fatty acids
  • C2-C8-saturated long-chain fatty acyl-[ACP] + 3 O2 + 2 reduced [flavodoxin] --> fatty aldehyde + 3 H+ + 3 H2O + 2 oxidized [flavodoxin] + pimeloyl-[ACP] (according to UniProt)
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|A95C28DEE73AD25E28C45B88A7C03C92835F9705|CypA], [protein|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|YjiB], [protein|EF0F13BB682791E167EFC350BF029B08E8A1F410|PksS]
  • Structure

  • [PDB|3EJB], [PDB|3EJE] (complex with [protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|AcpA]) [Pubmed|18838690]
  • Expression and Regulation



    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|8763940,8892842], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|8763940,8892842]
  • view in new tab

    Biological materials


  • MGNA-A804 (bioI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30190 ([gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATTTTCTCCTTTCT, downstream forward: _UP4_TAAGCCTAAGAATGTGAGTG
  • BKK30190 ([gene|8FBC9A1AC108DC99E275D7A27C18C797D3CDB936|bioI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTGATTTTCTCCTTTCT, downstream forward: _UP4_TAAGCCTAAGAATGTGAGTG
  • References


  • 21437340
  • Original publications

  • 18838690,8763940,8892842,15449931,15449930,12538057,20658980,11368323,11472016,14737344,12943422,28196402,28898812