SubtiBank SubtiBank
yrbG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrbG

unknown
locus
BSU_27680
pI
5.32
mw
25.08 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,831,124 2,831,780

    The protein

    Protein family

  • [SW|UPF0702 family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|8FDB9209CB172AB9C9EDB2279969CA8C880AD30B|yrbG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A823 (yrbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/823 NBRP B. subtilis, Japan]
  • BKE27680 ([gene|8FDB9209CB172AB9C9EDB2279969CA8C880AD30B|yrbG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGCACCTCCAACTCA, downstream forward: _UP4_AAAGATGGGCACCGCACGTG
  • BKK27680 ([gene|8FDB9209CB172AB9C9EDB2279969CA8C880AD30B|yrbG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGCACCTCCAACTCA, downstream forward: _UP4_AAAGATGGGCACCGCACGTG