SubtiBank SubtiBank
cotX
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotX

spore crust protein (insoluble fraction), necessary for the assembly of the spore crust, the outermost layer of the spore coat
locus
BSU_11760
pI
4.23
mw
18.46 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
spore crust assembly
product
spore crust protein (insoluble fraction)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,250,656 1,251,174

    The protein

    Modification

  • contains a glycosylation motif [pubmed|31502725]
  • [SW|Localization]

  • spore crust with a preference for spore poles [Pubmed|31502725,23202530]
  • Expression and Regulation

    Operons

    genes
    [gene|905148CAF82018E7F8E800FDF3F41163AAA8E682|cotX]
    description
    [Pubmed|7519271]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, before [protein|63870866AA2EA1727D77609B330FCD9704007679|CotV] [Pubmed|26577401,15699190,7519271], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, before [protein|63870866AA2EA1727D77609B330FCD9704007679|CotV], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7519271], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|26577401], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation ([SW|SigE], [protein|search|SigK], [protein|search|GerE], [protein|search|GerR]) [Pubmed|26577401]
  • view in new tab

    genes
    [gene|63870866AA2EA1727D77609B330FCD9704007679|cotV]-[gene|47669BC8073FB0F9799E06BB9FC39700F960910E|cotW]-[gene|905148CAF82018E7F8E800FDF3F41163AAA8E682|cotX]
    description
    [Pubmed|7519271]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,7519271], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7519271,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|15383836]
  • view in new tab

    Biological materials

    Mutant

  • BKE11760 ([gene|905148CAF82018E7F8E800FDF3F41163AAA8E682|cotX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATTCCTCCTTTTC, downstream forward: _UP4_TAGGACCTAAAAGCAGAGCT
  • BKK11760 ([gene|905148CAF82018E7F8E800FDF3F41163AAA8E682|cotX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATTCCTCCTTTTC, downstream forward: _UP4_TAGGACCTAAAAGCAGAGCT
  • References

    Reviews

  • 23202530,27227299
  • Original publications

  • 7519271,10788508,20451384,12107147,21665972,21821766,26821119,26577401,30582883,31502725