SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcription repressor of class III heat shock genes ([gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] operon, [gene|8C5B14FE5E03427F9A598C75D4081FA0D6696299|clpE], [gene|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|clpP])
17.60 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
regulation of protein degradation
transcription repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    101,449 101,913

    Phenotypes of a mutant

  • reduced expression of [gene|1BC439BBCD5FE19D5780519D7E4317C2EFF0D21B|trxB], due to reduced [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] activity [pubmed|30962353]
  • The protein

    Protein family

  • CtsR family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-55 (phosphorylation serves as tag for degradation by [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]) [Pubmed|27749819]
  • phosphorylation of a tyrosine residue by [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] [Pubmed|14984053]
  • recently, it was reported that CtsR is phosphorylated by [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] on Arg-62 rather than on a tyrosine residue [Pubmed|19498169]
  • in addition, Arg-15 was reported to be a phosphorylation site [Pubmed|22517742]
  • Effectors of protein activity

  • CtsR is inactivated by heat, heat sensing requires Gly-64 [Pubmed|20852588]
  • non-phosphorylated [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB] targets CtsR for degradation [Pubmed|20852588]
  • regulated proteolysis by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]/[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|11179229,16163393,17380125]
  • Structure

  • [PDB|3H0D] (complex with a 26bp DNA duplex, from ''Geobacillus stearothermophilus'') [Pubmed|19498169]
  • [PDB|6FH4] (C-terminal domain bound to phosphoarginine) [pubmed|30962626]
  • additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [pubmed|17981983]
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30962353], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • induction during diamide stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30962353]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • GP3202([gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • MGNA-B928 (yacG::erm), available at the [ NBRP B. subtilis, Japan]
  • ''ctsR::aphA3'' availbale in [SW|Ulf Gerth]'s lab
  • BKE00830 (''[gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE00830 ([gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAACCCCCTCCTTTAC, downstream forward: _UP4_AAATTAAAATAAGCGGGTGA
  • BKK00830 ([gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAACCCCCTCCTTTAC, downstream forward: _UP4_AAATTAAAATAAGCGGGTGA
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s lab
  • References


  • 14984053,21078442,23375660,27518094,28402413,28748186
  • Original Publications

  • 27749819,30962626,30962353,11179229,20852588