SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


c-di-AMP binding protein
16.49 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
c-di-AMP binding protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,485,453 1,485,896

    The protein


  • [SW|CBS domain] (aa 18-78) (according to UniProt)
  • Effectors of protein activity

  • binds c-di-AMP [pubmed|31061098]
  • Structure

  • [PDB|1YAV]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, by [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]~P [Pubmed|18840696,14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16395550,12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • MGNA-A773 (ykuL::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2769 (''Δ''''[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]''::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE14130 (''ykuL''::''erm trpC2'') available in the Bacillus Genetic Stock Center and in [SW|Jörg Stülke]'s lab [pubmed|28189581]
  • GP214 (deletion of ''[gene|A26502ADAC214D45A8F7F394587B0BDFBE7AF28E|ykuJ]-[gene|7FD784C885605F7FD27898BC9E83C28F21BE0E9D|ykuK]-[gene|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA]-[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]'', replaced by ''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE14130 ([gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTT
  • BKK14130 ([gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCGACCCCTTTTC, downstream forward: _UP4_TAGGCTGTACGGTCCTATTT
  • GP2800 (''Δ''''[gene|90AFF93D6E7BC993B2773C12EE400C80A87A4831|darB]-[gene|FE15A41A58A8177280817CA3825764C39185021A|ccpC]]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • pGP2929 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP635: expression of Strep-''ykuL'' by [SW|pGP380] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP767: expression of ''ykuL''-Strep by [SW|pGP382] in ''B. subtilis'' suitable for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP3306: expression of ''ykuL'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2810 ''ykuL-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References


  • 32603625
  • Original publications

  • 14651647,16395550,31061098,25215494