SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)
37.05 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
required for survival at low temperatures
transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • Gene

    2,294,286 2,295,281

    Phenotypes of a mutant

  • The mutant is cold-sensitive [ PubMed]
  • The protein

    Protein family

  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • Structure

  • [PDB|3DZD] (Aquifex aeolicus NtrC, corresponds to aa 12 ... 333 of YplP, 33% identity) [pubmed|18955063]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A896 (yplP::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2304 ( ''yplP''::aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE21780 ([gene|90C747D6D6194608C2CF9566F1740A6B20966A11|yplP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTGGCTCCTTTTGG, downstream forward: _UP4_TAGCGATCGAAAGGAGAATG
  • BKK21780 ([gene|90C747D6D6194608C2CF9566F1740A6B20966A11|yplP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTGGCTCCTTTTGG, downstream forward: _UP4_TAGCGATCGAAAGGAGAATG
  • References

  • 16585774,12399512,21906631,18955063