SubtiBank SubtiBank
spsJ
The papers of the month are back! Check them out! Link here

spsJ

dTDP -glucose-4,6-dehydratase, spore coat polysaccharide synthesis
locus
BSU37830
pI
6.29
mw
35.38 kDa
protein length
315 aa Sequence Blast
gene length
945 bp Sequence Blast
function
rhamnose biosynthesis, spore coat polysaccharide synthesis
product
dTDP -glucose-4,6-dehydratase
essential
no
ec
4.2.1.46
synonyms
ipa-72d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.7|Biosynthesis of rhamnose (for the exosporium)]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,884,292 → 3,885,239

    The protein

    Catalyzed reaction/ biological activity

  • dTDP-glucose -→ dTDP-4-dehydro-6-deoxyglucose [Pubmed|22960854]
  • Protein family

  • sugar epimerase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|9836E90BD443F5269A43E5C69FCF2CCB22EDF65B|YfnG]
  • Expression and Regulation

    Operons

    genes
    [gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]-[gene|9E577B935FAB9605DAF83353E907A6561F11CAC1|spsB]-[gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]-[gene|2648D9E356683F5E9C00C40F0A6BBD1933322B09|spsD]-[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]-[gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]-[gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]-[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]-[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]-[gene|4A4C5E6C1DFD46BC3CF9AEBA3FC1577767FF8465|spsK]-[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE37830 (Δ[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTAATTAAATATGATTTTG, downstream forward: _UP4_AATGACCGATGAGAAGGTGA
  • BKK37830 (Δ[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTAATTAAATATGATTTTG, downstream forward: _UP4_AATGACCGATGAGAAGGTGA
  • References

  • 9353933,15383836,22960854,25239894,26577401