SubtiBank SubtiBank
spoIIID
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIIID

transcriptional regulator (repressor or activator) of a subset of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigma E]-dependent genes
locus
BSU_36420
pI
9.50
mw
10.66 kDa
protein length
gene length
282 bp Sequence Blast
function
regulation of mother cell gene expression
product
transcriptional regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,748,421 3,748,702

    The protein

    Catalyzed reaction/ biological activity

  • binds its DNA targets as a monomeric protein (possible due to the two DNA-binding motifs) [Pubmed|20061473]
  • [SW|Domains]

  • two DNA-binding regions: HTH at the N-terminus and a basic region near the C-terminus [Pubmed|20061473]
  • Structure

  • [PDB|2L0K] (complex with DNA)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000006 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|487990143C84D245743C0014E648699627204FF0|usd]-[gene|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]-[gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|9023218], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|9023218]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mbl]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE36420 ([gene|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTGCACACCACTCGACC, downstream forward: _UP4_TAATCACCTGGCATTGCCTT
  • BKK36420 ([gene|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTGCACACCACTCGACC, downstream forward: _UP4_TAATCACCTGGCATTGCCTT
  • References

    Reviews

  • 31350897
  • Original Publications

  • 15383836,1469717,7896717,1900494,8231808,9023218,2112673,1691789,10788508,1744038,7966271,2514119,1518043,17693505,9006059,20061473,17890309,17693499,7836311,24584501,22463703,30953122