SubtiBank SubtiBank
spoIIID
The papers of the month are back! Check them out! Link here

spoIIID

transcriptional regulator (repressor or activator) of a subset of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigma E]-dependent genes
locus
BSU36420
pI
9.50
mw
10.66 kDa
protein length
gene length
279 bp Sequence Blast
function
regulation of mother cell gene expression
product
transcriptional regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,748,421 → 3,748,702

    The protein

    Catalyzed reaction/ biological activity

  • binds its DNA targets as a monomeric protein (possible due to the two DNA-binding motifs) [Pubmed|20061473]
  • [SW|Domains]

  • two DNA-binding regions: HTH at the N-terminus and a basic region near the C-terminus [Pubmed|20061473]
  • Structure

  • [PDB|2L0K] (complex with DNA)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000006 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|487990143C84D245743C0014E648699627204FF0|usd]-[gene|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]-[gene|6ED386D49F973C1F6B1076974F54275DD583C9D3|mbl]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|9023218], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|9023218]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|mbl]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE36420 (Δ[gene|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTGCACACCACTCGACC, downstream forward: _UP4_TAATCACCTGGCATTGCCTT
  • BKK36420 (Δ[gene|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|spoIIID]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCGTGCACACCACTCGACC, downstream forward: _UP4_TAATCACCTGGCATTGCCTT
  • References

  • 15383836,1469717,7896717,1900494,8231808,9023218,2112673,1691789,10788508,1744038,7966271,2514119,1518043,17693505,9006059,20061473,17890309,17693499,7836311,24584501,22463703