SubtiBank SubtiBank
yhjR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhjR

inner spore coat protein
locus
BSU_10610
pI
5.95
mw
17.09 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.2|Class II]
  • Gene

    Coordinates
    1,135,699 1,136,136

    The protein

    [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|90E4C0FFA7678C7034657237464C2B34EE261B79|yhjR]-[gene|C3966AC2F7160228C3B155132B40F0AF71D6FECA|yhjQ]
    description
    [Pubmed|22383849,12480901]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE], [protein|search|SigK], [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]) [Pubmed|12480901,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B289 (yhjR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1288 NBRP B. subtilis, Japan]
  • BKE10610 ([gene|90E4C0FFA7678C7034657237464C2B34EE261B79|yhjR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGGGATTCAACTCCATT, downstream forward: _UP4_TAGATATACCCATTCAGGGT
  • BKK10610 ([gene|90E4C0FFA7678C7034657237464C2B34EE261B79|yhjR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGGGATTCAACTCCATT, downstream forward: _UP4_TAGATATACCCATTCAGGGT
  • References

  • 12480901,15383836,22171814