SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


MarR/DUF24 family transcription regulator, positively controls the nitroreductase gene hypO in response to disulfide stress
14.59 kDa
protein length
125 aa Sequence Blast
gene length
375 bp Sequence Blast
control of the nitroreductase gene hypO in response to disulfide stress (diamide, NaOCl)
MarR/DUF24 family transcription regulator HypR

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    4,167,622 → 4,167,999

    The protein

    Protein family

  • [SW|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|C57DDC9710CB557179B062F9C5D786DB02A3B5FC|YkvN], [protein|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|YdzF], [protein|51B1913B59C1876CCED4A88414797B3A22BE4E3C|YdeP]
  • Kinetic information

  • Cys14 redox sensing Cys, has lower pKa of 6.36 [Pubmed|22238377]
  • [SW|Domains]

  • 5 alpha helices, 2 beta sheets, MarR-fold with wHTH motif, alpha4 major groove recognition helix, beta2 and 3 form the wing; alpha5 dimer interface [Pubmed|22238377]
  • Modification

  • oxidized to Cys14-Cys49' intersubunit disulfides by disulfide stress [Pubmed|22238377]
  • Cys14 and Cys49' are about 8-9 Angström apart in reduced HypR-Dimer, oxidation moves the major groove recognition alpha4 helices of the HypR dimer about 4 Angstroem towards each other that leads to activation of HypR [Pubmed|22238377]
  • Structure

  • [PDB|4A5N] (reduced HypRC14S dimer) [Pubmed|22238377]
  • [PDB|4A5M] (oxidized HypR C14-C49' intersubunit disulfide-linked dimer ) [Pubmed|22238377]
  • [SW|Localization]

  • cytoplasmic
  • Expression and Regulation



    regulatory mechanism

  • [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR]: activation, (autoregulation)[Pubmed|22238377], in [regulon|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR regulon]
  • regulation

  • activated by disulfide stress conditions (diamide, NaOCl) ''in vivo'' and ''in vitro '' (autoregulation) [Pubmed|22238377]
  • view in new tab

    Biological materials


  • MGNA-B836 (yybR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40540 (Δ[gene|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|hypR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACCCTCCAATAG, downstream forward: _UP4_TAGCAGCAAAGGGAACTCCT
  • BKK40540 (Δ[gene|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|hypR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACCCTCCAATAG, downstream forward: _UP4_TAGCAGCAAAGGGAACTCCT
  • Labs working on this gene/protein

  • [SW|Haike Antelmann],University of Greifswald, Germany