SubtiBank SubtiBank
yvfT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvfT

two-component sensor kinase
locus
BSU_34070
pI
8.93
mw
37.21 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
function
unknown
product
two-component sensor kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,496,495 3,497,481

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|5BB2B90D5DDD50DD9B4EF9E69925FCBFA642222B|YvfU]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK]
  • [SW|Domains]

  • 4 transmembrane segments
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A483 (yvfT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/483 NBRP B. subtilis, Japan]
  • BKE34070 ([gene|91110611D775A1746766D43BDF50F2F6D345B625|yvfT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAGATATTGCCTTTTTCA, downstream forward: _UP4_GCAGAATGATTGGAGGACGA
  • BKK34070 ([gene|91110611D775A1746766D43BDF50F2F6D345B625|yvfT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATAGATATTGCCTTTTTCA, downstream forward: _UP4_GCAGAATGATTGGAGGACGA
  • References

  • 10094672