SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcription activator of the [gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|search|glcP ]operon
37.53 kDa
protein length
329 aa Sequence Blast
gene length
987 bp Sequence Blast
regulation of the [gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|search|glcP ]operon
transcriptional regulator ([SW|LacI family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,129,715 → 1,130,704

    The protein

    Catalyzed reaction/ biological activity

  • transcription activation of the ''[gene|2F850E2DFA6287DB3890243803E06FDE7ACDB10E|ntdA]-[gene|A4DE6C394B64813A732255734758403241FFAC2F|ntdB]-[gene|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|ntdC]-[gene|ADB476B0B385D9B9CAF02902CE115C8309F67911|glcP]'' operon [Pubmed|17056753]
  • Protein family

  • [SW|LacI family]
  • Structure

  • [PDB|2HSG] ([protein|search|ccpA ]from B. megaterium, 31% identity) [pubmed|17500051]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • MGNA-A726 (yhjM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10560 (Δ[gene|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTTCCTTAAA, downstream forward: _UP4_TAACGATAGATTTCCCTTTA
  • BKK10560 (Δ[gene|9118A36CD30E7C99697B3659BB04E03BB7EE71D7|ntdR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTTCCCTTCCTTAAA, downstream forward: _UP4_TAACGATAGATTTCCCTTTA
  • References


  • 21512256
  • Original publications

  • 14612444,20817675,17056753