SubtiBank SubtiBank
ytwI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytwI

unknown
locus
BSU_29150
pI
9.86
mw
15.92 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,982,603 2,983,067

    The protein

    Protein family

  • UPF0756 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|91F49B5BF60EB2712747935166F21E65E8B75534|ytwI]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B522 (ytwI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1521 NBRP B. subtilis, Japan]
  • BKE29150 ([gene|91F49B5BF60EB2712747935166F21E65E8B75534|ytwI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGCCATCCCTCCTTTA, downstream forward: _UP4_TAAAAAAAAGCGGCCTTAAA
  • BKK29150 ([gene|91F49B5BF60EB2712747935166F21E65E8B75534|ytwI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGCCATCCCTCCTTTA, downstream forward: _UP4_TAAAAAAAAGCGGCCTTAAA
  • References

  • 9387221