SubtiBank SubtiBank
yqxC

yqxC

similar to rRNA methyltransferase
locus
BSU_24260
pI
10.11
mw
29.50 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
function
unknown
product
putative rRNA methyltransferase
essential
no
synonyms
yqiF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    2,522,871 2,523,716

    The protein

    Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • TlyA family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 6-67) (according to UniProt)
  • [SW|Cofactors]

  • SAM [pubmed|28031456]
  • Structure

  • [PDB|3HP7] (from Streptococcus thermophilus, 60% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]
    description
    [Pubmed|2507400]

    additional information

  • the terminator is [protein|search|NusA]-dependent [ http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    genes
    [gene|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|dxs]-[gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]-[gene|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]-[gene|5680A06A74D3EC6310EF8677795511C75DB3059E|recN]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, [pubmed|11948165], in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C369 (yqxC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2367 NBRP B. subtilis, Japan]
  • BKE24260 ([gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTAATCGTTCTTTCTTTG, downstream forward: _UP4_TAATAGGGCGCTATTATTCC
  • BKK24260 ([gene|923C4177500E9678A0B4855F8F481D4A36ECD863|yqxC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCTAATCGTTCTTTCTTTG, downstream forward: _UP4_TAATAGGGCGCTATTATTCC
  • References

  • 2507400,28031456,20854656,21443791