SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcription activator of the gutB-gutP operon
94.88 kDa
protein length
829 aa Sequence Blast
gene length
2490 bp Sequence Blast
regulation of glucitol utilization
transcription activator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucitol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    664,775 667,264

    The protein


  • three [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE06140 ([gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCTGCACCTCCTAT, downstream forward: _UP4_TAGTACGTAGTTCTGTCAGC
  • BKK06140 ([gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCTGCACCTCCTAT, downstream forward: _UP4_TAGTACGTAGTTCTGTCAGC
  • References

  • 11390381,8195087,8195086,11118449,12897001