SubtiBank SubtiBank
gutR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gutR

transcription activator of the gutB-gutP operon
locus
BSU_06140
pI
6.11
mw
94.88 kDa
protein length
829 aa Sequence Blast
gene length
2490 bp Sequence Blast
function
regulation of glucitol utilization
product
transcription activator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.11|Utilization of glucitol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    664,775 667,264

    The protein

    [SW|Domains]

  • three [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]
    description
    [Pubmed|12897001]
    view in new tab

    Biological materials

    Mutant

  • BKE06140 ([gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCTGCACCTCCTAT, downstream forward: _UP4_TAGTACGTAGTTCTGTCAGC
  • BKK06140 ([gene|926BCA197F259558F72FDCC73998497B9B167D22|gutR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCTGCACCTCCTAT, downstream forward: _UP4_TAGTACGTAGTTCTGTCAGC
  • References

  • 11390381,8195087,8195086,11118449,12897001