SubtiBank SubtiBank
rsbP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rsbP

protein serine phosphatase, energy PP2C, dephosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV], required for activation of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] during bacterial-fungal interaction
locus
BSU_34110
pI
4.83
mw
45.87 kDa
protein length
403 aa Sequence Blast
gene length
1212 bp Sequence Blast
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
product
protein serine phosphatase, energy PP2C
essential
no
ec
3.1.3.3
synonyms
yvfP

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    3,500,386 3,501,597

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV] in response to red light, this results in [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activation [Pubmed|19948797]
  • H2O + O-phospho-L(or D)-serine --> L(or D)-serine + phosphate (according to UniProt)
  • [SW|Domains]

  • N-terminal [SW|PAS domain], central coiled-coil domain
  • [SW|PPM-type phosphatase domain] (aa 191-402) (according to UniProt)
  • Effectors of protein activity

  • activity is stimulated upon interaction of the RsbP oligomer with RsbQ [Pubmed|21980452]
  • Expression and Regulation

    Operons

    genes
    [gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]-[gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A488 (yvfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/488 NBRP B. subtilis, Japan]
  • BKE34110 ([gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • BKK34110 ([gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • labs

  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

    Reviews

  • 20658979,33042030
  • Original publications

  • 27977677,19948797,21980452,10632888,15632289,30396900,30824454,31210376,32075967