SubtiBank SubtiBank
rsbP

rsbP

protein serine phosphatase, energy PP2C, dephosphorylates [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV], required for activation of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] during bacterial-fungal interaction
locus
BSU_34110
pI
4.83
mw
45.87 kDa
protein length
403 aa Sequence Blast
gene length
1212 bp Sequence Blast
function
control of [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activity
product
protein serine phosphatase, energy PP2C
essential
no
ec
3.1.3.3
synonyms
yvfP

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • Gene

    Coordinates
    3,500,386 3,501,597

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|AC64DA463250A090A62E50901EFE653C8F963872|RsbV] in response to red light, this results in [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] activation [Pubmed|19948797]
  • H2O + O-phospho-L(or D)-serine --> L(or D)-serine + phosphate (according to UniProt)
  • [SW|Domains]

  • N-terminal [SW|PAS domain], central coiled-coil domain
  • [SW|PPM-type phosphatase domain] (aa 191-402) (according to UniProt)
  • Effectors of protein activity

  • activity is stimulated upon interaction of the RsbP oligomer with RsbQ [Pubmed|21980452]
  • Expression and Regulation

    Operons

    genes
    [gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]-[gene|53496D7AC05B20C5AEB6CB9B9B8825FC987B12C5|rsbQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A488 (yvfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/488 NBRP B. subtilis, Japan]
  • BKE34110 ([gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • BKK34110 ([gene|9284E58A2D5394A31658E70879874A1338CF531B|rsbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGAGGGTCACCTCT, downstream forward: _UP4_TAAAATGATCCATGAGACAT
  • labs

  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

    Reviews

  • 20658979
  • Original publications

  • 27977677,19948797,21980452,10632888,15632289,30396900,30824454,31210376