SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


c-di-AMP exporter
58.17 kDa
protein length
532 aa Sequence Blast
gene length
1599 bp Sequence Blast
secretion of cyclic di-AMP
c-di-AMP exporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other exporters]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    977,775 979,373

    The protein

    Catalyzed reaction/ biological activity

  • secretion of cyclic di-AMP [pubmed|29588402]
  • Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|EmrB family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|188742B9A0C95344D32A4C23B9C971660572CF7D|YcnB], [protein|23483430AE0381406EF2349A18CFAE1F14F9B180|LmrB]
  • Structure

  • [PDB|6E8J] (from Hyphomonas neptunium, corresponds to aa 93 ... 204, 28% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 4 to 41 min) [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-B471 (yhcA::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1704 (''[gene|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA]''::''ermC'', without terminator), available in [SW|Jörg Stülke]'s lab
  • BKE09010 ([gene|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGACAACCTCCTTT, downstream forward: _UP4_TAATCTGTACAGGGAGGTTT
  • BKK09010 ([gene|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAAGACAACCTCCTTT, downstream forward: _UP4_TAATCTGTACAGGGAGGTTT
  • References

  • 21815947,29588402