SubtiBank SubtiBank
folEB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

folEB

GTP cyclohydrolase IB, required for the initial step of queuosine synthesis ([SW|tRNA modification]), replaces [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE] under conditions of zinc starvation
locus
BSU_03340
pI
7.83
mw
34.63 kDa
protein length
305 aa Sequence Blast
gene length
915 bp Sequence Blast
function
biosynthesis of folate and queuosine
product
zinc-independent GTP cyclohydrolase IB
essential
no
ec
3.5.4.16
synonyms
folE2,yciA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.5|Biosynthesis of folate]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    364,259 → 365,173

    The protein

    Catalyzed reaction/ biological activity

  • GTP + H2O --> 7,8-dihydroneopterin 3'-triphosphate + formate + H+ (according to UniProt)
  • Protein family

  • GTP cyclohydrolase IV family (single member, according to UniProt)
  • [SW|Cofactors]

  • activated by a variety of divalent cations [Pubmed|19767425]
  • Structure

  • [PDB|3D1T] [Pubmed|19767425]
  • Expression and Regulation

    Operons

    genes
    [gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|9811636]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • [SW|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]) [Pubmed|12426338]
  • view in new tab

    Biological materials

    Mutant

  • BKE03340 (Δ[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGAAAACTCCTCTCA, downstream forward: _UP4_TTTTCGAAGGAAGTGGATAA
  • BKK03340 (Δ[gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGAAAACTCCTCTCA, downstream forward: _UP4_TTTTCGAAGGAAGTGGATAA
  • References

  • 9811636,12426338,17032654,19767425,27561249