SubtiBank SubtiBank
sirB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sirB

sirohydrochlorin ferrochelatase
locus
BSU_15620
pI
6.06
mw
28.69 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
function
siroheme biosynthesis, sulfite reduction
product
sirohydrochlorin ferrochelatase
essential
no
synonyms
ylnE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    1,634,837 1,635,622

    The protein

    Catalyzed reaction/ biological activity

  • insertion of Fe2+ into the substrate sirohydrochlorin (SHC) in siroheme biosynthesis [pubmed|30778451]
  • 2 H+ + siroheme --> Fe2+ + sirohydrochlorin (according to UniProt)
  • Protein family

  • CbiX family (single member, according to UniProt)
  • Structure

  • Apo-form: [PDB|5ZT8] [pubmed|30778451]
  • Co2+ bound: [PDB|5ZT7] ([pubmed|30778451]), [PDB|6JV6]
  • Ni2+ bound: [PDB|5ZT9]
  • Fe3+ bound: [PDB|5ZTA]
  • Expression and Regulation

    Operons

    genes
    [gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
    description
    [Pubmed|11004190]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11004190], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B369 (ylnE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1368 NBRP B. subtilis, Japan]
  • BKE15620 ([gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATAAAATTGCTTGTTTCA, downstream forward: _UP4_CAATTTGATTTTGATGGAGG
  • BKK15620 ([gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATATAAAATTGCTTGTTTCA, downstream forward: _UP4_CAATTTGATTTTGATGGAGG
  • References

  • 16267287,11004190,12107147,18039762,30778451