SubtiBank SubtiBank
ydjH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydjH

unknown
locus
BSU_06200
pI
5.93
mw
28.01 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    673,019 673,783

    The protein

    Protein family

  • UPF0603 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3B6F4FBB19401069E827EAF5835DD15AAA3C3487|pspA]-[gene|F93381205C61665820D034A384BD60410AAE84C1|ydjG]-[gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]-[gene|CA4EF8385EAA4BBC47FF0D998C820D9F36F5F94D|ydjI]
    description
    [Pubmed|11454200]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11454200], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by alkaline shock ([protein|search|SigW]) [Pubmed|11454200]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C215 (ydjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2213 NBRP B. subtilis, Japan]
  • BKE06200 ([gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTTCCCAAAAAATCCAC, downstream forward: _UP4_TAAATGTAAGAAATAGAGAA
  • BKK06200 ([gene|938B55332DFB2B465D0D5AD530550CED5AC30A92|ydjH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTTCCCAAAAAATCCAC, downstream forward: _UP4_TAAATGTAAGAAATAGAGAA
  • References

  • 11454200,18840696