SubtiBank SubtiBank
csrA
The papers of the month are back! Check them out! Link here

csrA

motility regulator, binds to the [gene|search|hag ]mRNA to inhibit its translation
locus
BSU35370
pI
6.09
mw
8.00 kDa
protein length
gene length
222 bp Sequence Blast
function
control of [gene|search|hag ]translation
product
motility regulator
essential
no
synonyms
yviG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    Coordinates
    3,636,046 → 3,636,270

    The protein

    Catalyzed reaction/ biological activity

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] binds the ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mRNA to inhibit translation [Pubmed|21895793]
  • Protein family

  • csrA family (according to Swiss-Prot)
  • Effectors of protein activity

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] is sequestered by interaction with [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] (the two proteins form a conserved module in many bacteria) [Pubmed|21895793,27516547]
  • Structure

  • [PDB|1T3O]
  • [PDB|5DMB] ([protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW]-[protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] complex) [Pubmed|27551070]
  • Additional information

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA] and [protein|6A6CBD75DCC33C804F853F47D37773930D398CFE|FliW] form a conserved module in many bacteria [Pubmed|21895793]
  • Expression and Regulation

    Operons

    genes
    [gene|45F27C0789199626BA90D2C69E8F13525C911478|comFA]-[gene|D290247A43280532947B707F3AF388D7A7F404D3|comFB]-[gene|04D9D70C0BCFDCBD00B5156908C348135080A9C2|comFC]-[gene|049B1EBF64F0EBC04CE6D529C8EDB0B6B2184DF5|yvyF]-[gene|F03144BF8A187C8931938A21433431B8961E8EE7|flgM]-[gene|6F4CD36D4C1EE99EF7A503F44F53AEB8EFFEAB7F|yvyG]-[gene|767ADBEF1B40CB3C74116CEA8CFB2FAF19C1FE7B|flgK]-[gene|82AB04023BCB57967C7501E6AEAC4BB593AA6480|flgL]-[gene|E5A59D2AF53FA220BA98D9653589A8F0D24F75B8|yviE]-[gene|6A6CBD75DCC33C804F853F47D37773930D398CFE|fliW]-[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8412657], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8045879], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8412657], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|21736639], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19898538], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • view in new tab

    genes
    [gene|93F328524989597C7D2329B25E665496C9631E87|csrA]
    description
    [Pubmed|8969505]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A392 (csrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/392 NBRP B. subtilis, Japan]
  • GP469 (spc), available in [SW|Stülke] lab
  • BKE35370 (Δ[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG
  • BKK35370 (Δ[gene|93F328524989597C7D2329B25E665496C9631E87|csrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTTTATTTTCCGCGATA, downstream forward: _UP4_TGAGGATTTTTTTATTTTTG
  • Expression vector

  • pGP381 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Stülke] lab
  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP383, available in [SW|Stülke] lab
  • lacZ fusion

  • pGP461 (in [protein|search|pAC7]), available in [SW|Stülke] lab
  • References

    Reviews

  • 19385727,22672726,25251856
  • Original Publications

  • 16822857,17555441,8969505,21895793,23144244,26577401,27516547,27551070