SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cystine and diaminopimelate [SW|ABC transporter] (permease)
26.24 kDa
protein length
234 aa Sequence Blast
gene length
705 bp Sequence Blast
cystine and diaminopimelate uptake
cystine and diaminopimelate [SW|ABC transporter] (permease), membrane protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    409,965 410,669

    The protein

    Catalyzed reaction/ biological activity

  • uptake of cystine and diaminopimelate [pubmed|29995990]
  • Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|YxeN], [protein|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|YckA]
  • Structure

  • [PDB|4YMS] (amino acid transporter from Caldanaerobacter subterraneus, 37% identity) [pubmed|25848002]
  • [SW|Localization]

  • membrane protein [Pubmed|10092453,18763711]
  • Expression and Regulation




  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials


  • MGNA-C059 (yckJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03600 ([gene|9400DF25487461E3738DDDC72BDDB1589281409D|tcyB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGCCAAGCGTCAATGCCG, downstream forward: _UP4_GTGGCCAAATAAGGAGGTTC
  • BKK03600 ([gene|9400DF25487461E3738DDDC72BDDB1589281409D|tcyB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTGCCAAGCGTCAATGCCG, downstream forward: _UP4_GTGGCCAAATAAGGAGGTTC
  • References

  • 15262924,10092453,7551042,18763711,25848002,29995990