SubtiBank SubtiBank
yrbE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yrbE

similar to dehydrogenase
locus
BSU_27770
pI
5.71
mw
37.63 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,838,847 2,839,872

    The protein

    Protein family

  • [SW|Gfo/Idh/MocA family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|IolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|YfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|YteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|IolW], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|IolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|IolG]
  • Structure

  • [PDB|3EUW] (from ''Corynebacterium glutamicum'', 38% identity, 52% similarity)
  • Biological materials

    Mutant

  • MGNA-A822 (yrbE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/822 NBRP B. subtilis, Japan]
  • BKE27770 ([gene|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTCTTCCCCCTTGA, downstream forward: _UP4_TAATCTAACAGGATTACAAT
  • BKK27770 ([gene|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTCTTCCCCCTTGA, downstream forward: _UP4_TAATCTAACAGGATTACAAT