The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yrbE

similar to dehydrogenase

locus: BSU_27770

pI: 5.71

mw: 37.63 kDa

protein length: 341 aa

gene length: 1026 bp

function: unknown

product: unknown

essential: no

synonyms

Genomic Context

categories

• [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]

Gene

Coordinates: 2,838,847 2,839,872

The protein

Protein family

• [SW|Gfo/Idh/MocA family] (according to UniProt)

Paralogous protein(s)

• [protein|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|IolX], [protein|03BE6DA854612B3F6741E0E167AB310F0DE96285|YfiI], [protein|29DAF5343A42EAD8DB97925FE7D049410F7B7FCA|NtdC], [protein|484D17480DFAD3667E0EBC6D38854A7546A8DB46|YteT], [protein|7DFE74C751A67CCC84579D52005E1399B0A10166|IolW], [protein|920C5750CB95102B073C32874D512E8D636D2C7D|IolU], [protein|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|IolG]

Structure

• [PDB|3EUW] (from ''Corynebacterium glutamicum'', 38% identity, 52% similarity)

Biological materials

Mutant

• MGNA-A822 (yrbE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/822 NBRP B. subtilis, Japan]
• BKE27770 ([gene|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTCTTCCCCCTTGA, downstream forward: _UP4_TAATCTAACAGGATTACAAT
• BKK27770 ([gene|942BAE9FA023DFCA06B6D26A856A72F2979E23FA|yrbE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTCTTCCCCCTTGA, downstream forward: _UP4_TAATCTAACAGGATTACAAT