SubtiBank SubtiBank
dgkB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

dgkB

diacylglycerol kinase
locus
BSU_06720
pI
5.64
mw
33.18 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
function
biosynthesis of lipoteichoic acid
product
diacylglycerol kinase
essential
no
ec
2.7.1.107
synonyms
yerQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.3|Biosynthesis of lipoteichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.2|Biosynthesis of lipoteichoic acid]
  • Gene

    Coordinates
    736,436 737,347

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycerol + ATP --> 1,2-diacyl-sn-glycero-3-phosphate + ADP + H+ (according to UniProt)
  • Protein family

  • diacylglycerol/lipid kinase family (with [protein|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|BmrU] and [protein|ED4C1EA16FF96DA20F12B972CD2458FA3B49DDA5|YtlR], according to UniProt)
  • Paralogous protein(s)

  • [protein|88AECCE90DC0D6C92C61AB8860A31A830A8DAC42|BmrU]
  • [SW|Domains]

  • DAGKc domain (aa 1-132) (according to UniProt)
  • Structure

  • [PDB|3S40] (from ''B. anthracis'', 32% identity, 68% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]-[gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]-[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|dnmA]-[gene|2E55D086DD5023B98929FB8B61238C00E66B8BCB|yeeB]-[gene|DB1AAC91947A6008F631266E5CC85B58703AFD9D|yeeC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B448 (yerQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1447 NBRP B. subtilis, Japan]
  • GP1391 ''dgkB::cat ltaS::aphA3'', available in [SW|Jörg Stülke]'s lab
  • BKE06720 ([gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTCATCATCCTACT, downstream forward: _UP4_TAAAACTTGGCTTGGTAAGC
  • BKK06720 ([gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATCTCATCATCCTACT, downstream forward: _UP4_TAAAACTTGGCTTGGTAAGC
  • References

    Reviews

  • 24819367
  • Original publications

  • 17535816,22451476,28189581