SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


intracellular alkaline serine protease
47.74 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
protein degradation
intracellular alkaline serine protease

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of proteins]
  • Gene

    1,861,384 1,862,712

    The protein

    Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Peptidase S8 domain] (aa 122-439) (according to UniProt)
  • Structure

  • [PDB|3WHI] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|AprE], corresponds to aa 78 ... 436, 33% identity) [pubmed|24279884]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10589719], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials


  • MGNA-A019 (aprX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA, downstream forward: _UP4_TAAACATCATCAAAAGCCGG
  • BKK17260 ([gene|945A1332A020CF842DA590589C88C758DE65C84E|aprX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTTTCCTCCTATTA, downstream forward: _UP4_TAAACATCATCAAAAGCCGG
  • References

  • 10589719,16267290,24279884
  • Labs working on this gene/protein

  • [SW|Alessandra Albertini], University of Pavia, Italy [ homepage]