SubtiBank SubtiBank
sufA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sufA

Fe-S carrier protein
locus
BSU_32160
pI
4.52
mw
12.61 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
assembly of Fe-S clusters
product
Fe-S carrier
essential
no
synonyms
yutM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.3|Biosynthesis of iron-sulfur clusters]
  • Gene

    Coordinates
    3,305,599 3,305,961

    The protein

    Protein family

  • HesB/IscA family (with [protein|5959516D55C9EDBFC46F28C8248D374832895740|YneR], according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|1R94] (from ''E. coli'') [Pubmed|14705938]
  • Expression and Regulation

    Operons

    genes
    [gene|94A3B5EF4ADCFA57A204B584B6D305A62E3E15AE|sufA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|185B6596F0468B76BCA85E8753063FAE83445E18|dapF]-[gene|94A3B5EF4ADCFA57A204B584B6D305A62E3E15AE|sufA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A969 (yutM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/969 NBRP B. subtilis, Japan]
  • BKE32160 ([gene|94A3B5EF4ADCFA57A204B584B6D305A62E3E15AE|sufA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATGAACCTCCTTT, downstream forward: _UP4_TAAGCACTAAAAACGGATAG
  • BKK32160 ([gene|94A3B5EF4ADCFA57A204B584B6D305A62E3E15AE|sufA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTATGAACCTCCTTT, downstream forward: _UP4_TAAGCACTAAAAACGGATAG
  • References

  • 20097860,14705938